A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
Our undergraduate program incorporates hands-on courses with unique electives to provide a robust and personalized curriculum. We prepare you for a breadth of careers including design, production, ...
We all use WhatsApp for daily conversations, but when it comes to using it for our enterprise, we face many challenges. Data ...
Some results have been hidden because they may be inaccessible to you
Show inaccessible results